Nucleotide sequence determination of bacteriophage T4 species I ribonucleic acid.
نویسندگان
چکیده
The nucleotide sequence of T4 species I RNA, one of several stable RNA's specifically coded for by bacteriophage T4, has been determined using 32-P-labeled material from T4-infected cultures of Escherichia coli. The purified RNA species which has been sequenced has been shown to hybridize well to T4 DNA (Wilson J.H., Kim, J.S., and Abelson, J.N. (1972) J. Mol. Biol. 71, 547-556). The sequence is: pCGAUUCGAGGAAAUAUCUUUGCCGUAAGCCGAGUAGCGUUUUUGACGGAACGUUCGGAUAUGGUUGAGAUAUGGCCUUUUAAAAUAUUGAGUAGCGUCAACUACUUAAUAACCGGGUUCGAAUCCCGGCGUUUCGU-CAA-OHACA-OH. Species I RNA which is 140 nucleotides long is also found to occur in shorter versions with 135 to 136 nucleotides which terminate with a 3'-phosphate. The molecule can be arranged in a secondary structure which shows some striking similarities to the classic cloverleaf pattern of a tRNA. The molecule is specifically cleaved by an E. coli nuclease into three segments by cleavage at a double-stranded region in the molecule. The function of species I RNA is unknown, but evidence presented elsewhere (Paddock, G.V., and Abelson, J. (1975) J. Biol. Chem. 250, 4207-4219) indicates that the gene for this RNA molecule has been preserved in evolution. The position of a mutation within species I RNA has been determined. This mutation results in incorrect processing of the RNA and lower relative yields of the RNA are present.
منابع مشابه
Nucleotide sequence determination of bacteriophage T4 leucine transfer ribonucleic acid.
The nucleotide sequence of a T4 tRNA with an anticodon for glycine has been determined using (32)P-labeled material from T4-infected cultures of Escherichiacoli. The sequence is: pGCGGAUAUCGUAUAAUGmGDAUUACCUCAGACUUCCAApsiCUGAUGAUGUGAGTpsiCGAUUCUCAUUAUCCGCUCCA-OH. The 74 nucleotide sequence can be arranged in the classic cloverleaf pattern for tRNAs. The anticodon of T4 tRNA(Gly) is UCC with a p...
متن کاملNucleotide sequence of an arginine transfer ribonucleic acid from bacteriophage T4.
The nucleotide sequence of a phage T4-coded low molecular weight RNA, previously designated polyacrylamide gel band epsilon, has been determined. This RNA can be arranged in the cloverleaf configuration common to tRNAs, with an anticodon sequence, U-C-U, which corresponds to the arginine-specific codons A-G-A and A-G-G; it is therefore assumed to be an arginine tRNA. The complete nucleotide seq...
متن کاملDetermination of Glutathione S-Transferase e2 Region (GSTe2) in DDT Susceptible and Resistant Anopheles stephensi Populations: Significance and Application of Nucleotide and Amino Acid Comparison
Glutathione S-transferases (GSTs) are a major family of detoxification enzymes which possess a wide range of substrate specificities. Interest in insect GSTs has primarily focused on their role in insecticide resistance. In this study, following World Health Organization (WHO) routine susceptibility test, DNA was extracted from specimens of Anopheles stephensi collected from the Kazeroon distri...
متن کاملNucleotide sequence of a type II DNA topoisomerase gene. Bacteriophage T4 gene 39.
T4 DNA topoisomerase is a type II enzyme and is thought to be required for normal T4 DNA replication T4 gene 39 codes for the largest of the three subunits of T4 DNA topoisomerase. I have determined the nucleotide sequence of a region of 2568 nucleotides of T4 DNA which includes gene 39. The location of the gene was established by the identification of the first fifteen amino acids in the large...
متن کاملInhibition of ribonucleic acid bacteriophage release from its host by rifampin.
Rifampin, in addition to interfering with intracellular growth of the ribonucleic acid-containing phage MS2, also inhibits the release of mature phage particles from Escherichia coli cells.
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
- The Journal of biological chemistry
دوره 250 11 شماره
صفحات -
تاریخ انتشار 1975